View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_39 (Length: 254)
Name: NF19916_low_39
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 40282448 - 40282565
Alignment:
| Q |
1 |
tggctttccatctttgccagcacatctttttagcacaaaaactaatgagagtaggacttaggaaaagttgtatcagagagaaagaggtgggatgtgttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40282448 |
tggctttccatctttgccagcacatctttttagcacaaaaactaatgagagtaggacttaggaaaagttgtatcagagagaaagaggtgggatgtgttta |
40282547 |
T |
 |
| Q |
101 |
aaatacaaaatattactg |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40282548 |
aaatacaaaatattactg |
40282565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 40282587 - 40282638
Alignment:
| Q |
190 |
atttaaatgtggtccacccaatgatccaaggctcaatattttattttttgat |
241 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
40282587 |
atttaaatgtggtccacccagtgatccaaggctcgatattttattttttgat |
40282638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University