View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19916_low_40 (Length: 253)

Name: NF19916_low_40
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19916_low_40
NF19916_low_40
[»] chr5 (1 HSPs)
chr5 (60-237)||(20679548-20679725)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 60 - 237
Target Start/End: Original strand, 20679548 - 20679725
Alignment:
60 ttgttaaccgtcctttccaccataagggttgtcatctcttgtcggccatcactttatgttgctacatatacatgtttgattttgatcttcattgatgtca 159  Q
    ||||||||| |||||||||| |||||| || |||||  ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||    
20679548 ttgttaaccatcctttccacgataaggattatcatccgttgtcggacatcactttacgttgctacatatacatgtttgattttgatcttcattgatgcca 20679647  T
160 caacgtcacaatcagtttgattctcgtcggccatcgttatgcgaggtcttcaaaagggttttaagttttggagtacga 237  Q
    ||||||||| || |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| ||||||||    
20679648 caacgtcacgataagtttgattctcgtcggccatcgttatgcgagatctccgaaagggttttaagttttagagtacga 20679725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University