View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_40 (Length: 253)
Name: NF19916_low_40
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 60 - 237
Target Start/End: Original strand, 20679548 - 20679725
Alignment:
| Q |
60 |
ttgttaaccgtcctttccaccataagggttgtcatctcttgtcggccatcactttatgttgctacatatacatgtttgattttgatcttcattgatgtca |
159 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20679548 |
ttgttaaccatcctttccacgataaggattatcatccgttgtcggacatcactttacgttgctacatatacatgtttgattttgatcttcattgatgcca |
20679647 |
T |
 |
| Q |
160 |
caacgtcacaatcagtttgattctcgtcggccatcgttatgcgaggtcttcaaaagggttttaagttttggagtacga |
237 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| |||||||| |
|
|
| T |
20679648 |
caacgtcacgataagtttgattctcgtcggccatcgttatgcgagatctccgaaagggttttaagttttagagtacga |
20679725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University