View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_46 (Length: 238)
Name: NF19916_low_46
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_46 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 33514635 - 33514853
Alignment:
| Q |
17 |
attatccgccaccgaaagcaaataatacagagactttcccgcgttctccagcacgggattctgattactcattaggttagttttcttttacgaagtttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33514635 |
attatccgccaccgaaagcaaataatacagagactttcccgcgttctccaacacgggattctgattactcattaggttagttttctttgacgaagtttaa |
33514734 |
T |
 |
| Q |
117 |
atccttcgtagtagatagtagtaaaattcaatttaatgtaacttctctctttctcaatcttttataaaatcatcttatatttgtgtttatatatataaac |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33514735 |
atccttcgtag---atagtagtaaaattcaatttaatgtaacttctctctttctcaatcttttataaaatcatcttatatttgtgtttatatatataaac |
33514831 |
T |
 |
| Q |
217 |
ttccaaaattctttaatatatt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33514832 |
ttccaaaattctttaatatatt |
33514853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University