View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_53 (Length: 219)
Name: NF19916_low_53
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 17519479 - 17519552
Alignment:
| Q |
16 |
aaaatatatttatagcacagtgcattaggatcttggttatagttggtcaattttgttttgaaaaatggttctta |
89 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
17519479 |
aaaatatatttatggcacagtgcattaggatcttggttatagttggtcaattttgttctgagaaatggttctta |
17519552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 17519748 - 17519830
Alignment:
| Q |
106 |
acttctatgtttttgcaggtgaaatagctcgtattggtgcagggtatgtatcttcttcttgttcaactttcattcacttgaag |
188 |
Q |
| |
|
||||| ||||||||| ||| || ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17519748 |
acttccatgtttttgtaggcgagatagctcgtattggtgcagggtacgtatcttctttttgttcaactttcattcacttgaag |
17519830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University