View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_high_23 (Length: 339)
Name: NF19917_high_23
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 33 - 322
Target Start/End: Complemental strand, 37188982 - 37188694
Alignment:
| Q |
33 |
tagtagtatataaagaaaataaagctatgacttggaaaagtagaggagaggttgttcctagaagctttatgtcacagaaatggatgattttcttgtgtat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37188982 |
tagtagtatataaagaaaataaagctatgacttggaaaagtagaggagaggttgttcctagaagctttatgtcacagaaatggatgattttcttgtgtat |
37188883 |
T |
 |
| Q |
133 |
tggaagcttctgtgctggaatgtttttcaccaacaggtacatgaattttctgtattgtcctgnnnnnnnnattgatgattgctttattatgtgttttcca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37188882 |
tggaagcttctgtgctggaatgtttttcaccaacaggtacatgaattttctgtattgtcctg-ttttttcattgatgattgctttattatgtgttttcca |
37188784 |
T |
 |
| Q |
233 |
ttgttttctaagcttaaaaatattannnnnnnnagtatatatttggtgttttgagatcttcataatagtattctatcactggttttccat |
322 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
37188783 |
ttgttttctaagcttaaaaatattattttttttagtatatatttggtgttttgagatcttcataagagtattctatcactagttttccat |
37188694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University