View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_high_49 (Length: 250)
Name: NF19917_high_49
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 17250662 - 17250882
Alignment:
| Q |
18 |
agataatgtgttgactaaattgcatgtataacaatgatcttcttttttatcataggattatgatgagaaaagactgtttttaaggtgcgagtttttagac |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17250662 |
agataatgtgtttactaaattgcatgtataacaatgatctccttttttatcataggattatgatgagaaaagattgtttttaaggtgcgagtttttagac |
17250761 |
T |
 |
| Q |
118 |
tactgcaaaagtgatagagacaaagtcaccaatgtcaccgaaacttaaagtcatcataatggaaacccccaactggcaatgtgctcacctcattagttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17250762 |
tactgcaaaagtgatagagacaaagtcaccaatgttgccgaaacttaaagtcatcataatggaaacccccaactggcaatgtgctcacctcattagttgt |
17250861 |
T |
 |
| Q |
218 |
tggtttgtttgattcgtcctt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17250862 |
tggtttgtttgattcgtcctt |
17250882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University