View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_high_57 (Length: 242)
Name: NF19917_high_57
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 49131749 - 49131969
Alignment:
| Q |
1 |
gtgcatttttagctgagagctattattttggcaggtgggatattcatcacccactcaagcagctatcagggcagatcttaatctatctatctctgaggtt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49131749 |
gtgcatttttagctgaaagctattattttggcaggtgggatattcatcacccactcaagcagctatcagggcagatcttaatctatctatctctgaggtt |
49131848 |
T |
 |
| Q |
101 |
agtattccaaatgaaaatgtcaatgaggaggggaatttgcaccaactaataataatgtcttgtcttgtggcagttttccatgtttggttctttagtaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49131849 |
agtattccaaatgaaaatgtcaatgaggaggggaatttgcaccaactaataataa-----tgtcttgtggcagttttccatgtttggttctttagtaaca |
49131943 |
T |
 |
| Q |
201 |
attggtgcaatgcttggagctataac |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49131944 |
attggtgcaatgcttggagctataac |
49131969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 168 - 226
Target Start/End: Original strand, 6925120 - 6925178
Alignment:
| Q |
168 |
tggcagttttccatgtttggttctttagtaacaattggtgcaatgcttggagctataac |
226 |
Q |
| |
|
||||||||||| |||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
6925120 |
tggcagttttcaatgtttggttctttggtgaccattggtgcaatgcttggagctataac |
6925178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 88
Target Start/End: Original strand, 6923009 - 6923065
Alignment:
| Q |
32 |
caggtgggatattcatcacccactcaagcagctatcagggcagatcttaatctatct |
88 |
Q |
| |
|
|||||||| |||||| ||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6923009 |
caggtgggttattcagcacccactcaagcggctatcagggctgatcttaatctatct |
6923065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University