View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19917_high_59 (Length: 233)

Name: NF19917_high_59
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19917_high_59
NF19917_high_59
[»] chr5 (2 HSPs)
chr5 (165-229)||(34207967-34208031)
chr5 (7-40)||(34207912-34207945)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 34207967 - 34208031
Alignment:
165 gaacattattaaacgaagatatcagagacatttgatatgttgcaacacgagtttgaatttgctag 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34207967 gaacattattaaacgaagatatcagagacatttgatatgttgcaacacgagtttgaatttgctag 34208031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 34207912 - 34207945
Alignment:
7 acatgctccacctgaaatgtgaccaaaatttaac 40  Q
    |||||||||||||||||||||| |||||||||||    
34207912 acatgctccacctgaaatgtgatcaaaatttaac 34207945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University