View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_high_61 (Length: 229)
Name: NF19917_high_61
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 46766189 - 46765978
Alignment:
| Q |
1 |
agaaaagcttgggacccccttttggggcagggtcatgtttgcttagggtcctgcacatagnnnnnnnnnnnnctatttgtatgttgtatttgaatgagct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46766189 |
agaaaagcttgggacccc-ttttggggcagggtcatgtttgcttagggtcctgcacatagttttttgtttttctatttgtatgttgtatttgaatgagct |
46766091 |
T |
 |
| Q |
101 |
tatnnnnnnnnnnnnnn-gtacaaacactaagttgcttaatttccactatcttaaaatcatgattatgagagtctataagggatagaaaaggtacttgaa |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46766090 |
tataaaaagaaaaaaaaagtacaaacactaagttgcttaatttccactatcttaaaatcatgattatgagagtctataagggatagaaaaggtacttgaa |
46765991 |
T |
 |
| Q |
200 |
tatggatggacac |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46765990 |
tatggatggacac |
46765978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University