View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19917_high_71 (Length: 203)

Name: NF19917_high_71
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19917_high_71
NF19917_high_71
[»] chr8 (1 HSPs)
chr8 (20-196)||(36125956-36126132)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 36126132 - 36125956
Alignment:
20 cacctatgcttttatccaacacttctccactccacccttccctcactatagattccacccacattgctaaatcttcatttgctcccttcccatgcctcaa 119  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36126132 cacctatgcttttatccaacacttctccactccacccatccctcactatagattccacccacattgctaaatcttcatttgctcccttcccatgcctcaa 36126033  T
120 ataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgttcttctctctcg 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||    
36126032 ataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctcttctcgctcg 36125956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University