View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_34 (Length: 291)
Name: NF19917_low_34
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 2902798 - 2902534
Alignment:
| Q |
18 |
gttttcgacttgccatatttggcagcacatgccttcttagaagatcttttccttataatagaaggaatgttttcataggtcattgctaagtttcttagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2902798 |
gttttcgacttgccatatttggcagcacatgccttcttagaagatcttttccttataatagaaggaatgttttcataggtcattgctaagtttcttagta |
2902699 |
T |
 |
| Q |
118 |
ccaattctgggctcatgtcgcttttgttattgctttccattccaacttgaactttcttctcatgattagccaattttaagtagttcgaataggaactatc |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2902698 |
ccgattctgggctcatgtcgcttttgttattgctttccattccaacttgaactttcttctcatgattagccaattttaagtagttcgaataggaactatc |
2902599 |
T |
 |
| Q |
218 |
agattcattaccagcaataaactttgattctgaaaaagaaaccttttgccatttgggagaattat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2902598 |
agattcattaccagcaataaactttgattctgaaaaagaagccttttgccatttgggagaattat |
2902534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 137 - 200
Target Start/End: Complemental strand, 2906773 - 2906709
Alignment:
| Q |
137 |
gcttttgttattgctttccattccaacttgaactttcttctcatgattagc-caattttaagtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
2906773 |
gcttttgttattgctttccattccaacttgaactttcttctcatgattagctcaattttgagtag |
2906709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 218 - 282
Target Start/End: Complemental strand, 2906710 - 2906649
Alignment:
| Q |
218 |
agattcattaccagcaataaactttgattctgaaaaagaaaccttttgccatttgggagaattat |
282 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2906710 |
agattcattaccag---taaactttgaatctgaaaaagaaactttttgccatttgggagaattat |
2906649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University