View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_38 (Length: 281)
Name: NF19917_low_38
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 12 - 260
Target Start/End: Original strand, 14744977 - 14745230
Alignment:
| Q |
12 |
ggcaagaatgacgaatataatgatagctggaatgcacttgggcaaaaacaa-gatgagtggtaaggggagatgatcagaaacgacgacaa----gagtta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
14744977 |
ggcaagaatgacgaatataatgatagctggaatgcacttgggcaaaaacaatgatgagtggtaaggggagatgatcagaaacgacgacaacaacgagtga |
14745076 |
T |
|
| Q |
107 |
aggtaaagatgagttaagaaggcattgagtgaccaagaagaagaataaagacgtaaggtttctttttggctgtgttttgagagagaataagtacagaggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14745077 |
aggtaaagatgagttaagaaggcattgagtgaccaagaagaagaataaagacgtaagggttctttttggctgtgttttgagagagaataagtacagagtt |
14745176 |
T |
|
| Q |
207 |
ttcatgacaaacatgttttgtattctaacggcgatttgactgaatgtaactgga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14745177 |
ttcatgacaaacatgttttgtattctaacggcgatttgactgaatgtaactgga |
14745230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University