View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_39 (Length: 274)
Name: NF19917_low_39
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 97 - 269
Target Start/End: Original strand, 40573562 - 40573734
Alignment:
| Q |
97 |
ccccctcaactggtccatggtgaccataataatgtggttttttggtgtgtagcttctcagcagcatgccttgctttagcttcatgtagctccatctttgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40573562 |
ccccctcaactggtccatggtgaccataataatgtggttttttggtgtgtagcttctcagcagcatgccttgctttagcttcatgtagctccatctttgc |
40573661 |
T |
|
| Q |
197 |
tttatgttctttagctttagcacgctcatgtgctatcactttctcctcttttgttcttgccattcttctctct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40573662 |
tttatgttctttagctttagcacgctcatgtgctatcactttctcctcttttgttcttgccattcttttctct |
40573734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 40573455 - 40573531
Alignment:
| Q |
20 |
ccttactggttcattttcttggtactgatttcctaccactgcttgtggctgatgaaccccaactggttcattttttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40573455 |
ccttactggttcattttcttggtactgatttcctaccactgcttctggctgatgaaccccaactggttcattttttg |
40573531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University