View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_42 (Length: 267)
Name: NF19917_low_42
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 2603089 - 2602833
Alignment:
| Q |
10 |
ataatactcctgtcagtcctgtgtg----gttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttc |
105 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2603089 |
ataatactcctgtcagtcctgtgtgtgtggttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttc |
2602990 |
T |
|
| Q |
106 |
tttctcttgataaaataaatgctcttacttagcttgtgcaaggaaacgaaatacattcaatgtaaattattactactaggttagaatagaaggaaaccaa |
205 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2602989 |
tttttcttgataaaataaatgctctta-----cttgtgcaaggaaacgaaatacattcaatgtaaattattactaataggttggaatagaaggaaaccaa |
2602895 |
T |
|
| Q |
206 |
gtatannnnnnngtttgtgtatggatacaaatattaatacattaatttggcgagttatgtta |
267 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2602894 |
gtatatttttttgtttgtgtatggatacaaatattaatacattaatttggcgagttatgtta |
2602833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University