View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_53 (Length: 249)
Name: NF19917_low_53
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 237
Target Start/End: Complemental strand, 35743193 - 35742980
Alignment:
| Q |
24 |
attttattagggcatcaaagttagattttgtattcatgattgatcactatgatttgttattattagggcattcaaagttagattttgcattgactcttct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743193 |
attttattagggcatcaaagttagattttgtattcatgattgatcactatgatttgttattattagggcattcaaagttagattttgcattgactcttct |
35743094 |
T |
 |
| Q |
124 |
gatatttcttgtgttgcatcggtattttgaagtcatatcgtaatatttacacttctgcttgcttgaatttgtagttcacttatgactctttccgatcaag |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743093 |
gatatttcttgtgttgcatcagtattttgaagtcagatcgtaatatttacacttctgcttgcttgaatttgtagttcacttatgactctttccgatcaag |
35742994 |
T |
 |
| Q |
224 |
aggatcaaattgat |
237 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35742993 |
aggatcaaattgat |
35742980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 35749425 - 35749376
Alignment:
| Q |
163 |
gtaatatttacacttctgcttgcttgaatttgtagttcacttatgactct |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
35749425 |
gtaatatttacacttgtgcttgcttgaatttgtagttaccttatgactct |
35749376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 16865281 - 16865311
Alignment:
| Q |
182 |
ttgcttgaatttgtagttcacttatgactct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16865281 |
ttgcttgaatttgtagttcacttatgactct |
16865311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University