View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_55 (Length: 243)
Name: NF19917_low_55
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40487997 - 40487766
Alignment:
| Q |
1 |
ttcaaaaaacagaggctcannnnnnngtctggctgattgtatacaagtatagaagaaaaggcatcagcaatatcttttatcnnnnnnnn-----gttgta |
95 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40487997 |
ttcaaaaaacagaggctcatttttttgtctggctgattgtatacaagtatagaagaaaaggcatcagcaatatcttttatcaaaaaaaaaaaaagttgta |
40487898 |
T |
|
| Q |
96 |
gcatcatcgagctttaaattagtgtttattgataatagtatgtgattttgcaactcatagtccatatttaggagggtaaatttccaatatgaggatcaga |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40487897 |
gcatcatcaagctttaaattagtgtttattgataatagtatgtgattttgcaactcatagtccatatttaggagggtaaatttccaatatgaggatcaga |
40487798 |
T |
|
| Q |
196 |
ggaatgaacatgcatgattagtggtttgattt |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
40487797 |
ggaacgaacatgcatgattagtggtttgattt |
40487766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University