View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_59 (Length: 234)
Name: NF19917_low_59
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 127 - 220
Target Start/End: Complemental strand, 4475016 - 4474923
Alignment:
| Q |
127 |
gtgtattatccaccgttaagaccccttgcatgatttaattgactcacatttatgtagaatacgagttgcatcttgctttatcaaatatttattg |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4475016 |
gtgttttatccaccgttaagaccccttgcatgatttaattgactcacatttatgtagaatacgagttgcatcttgctttatcaaatatttattg |
4474923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 21 - 60
Target Start/End: Complemental strand, 4475163 - 4475124
Alignment:
| Q |
21 |
taaggaaaaactaaatttagtgacatgaattaagggaaag |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4475163 |
taaggaaaaactaaatttagtgacatgaattaagggaaag |
4475124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University