View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_60 (Length: 233)
Name: NF19917_low_60
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 34207967 - 34208031
Alignment:
| Q |
165 |
gaacattattaaacgaagatatcagagacatttgatatgttgcaacacgagtttgaatttgctag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34207967 |
gaacattattaaacgaagatatcagagacatttgatatgttgcaacacgagtttgaatttgctag |
34208031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 34207912 - 34207945
Alignment:
| Q |
7 |
acatgctccacctgaaatgtgaccaaaatttaac |
40 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
34207912 |
acatgctccacctgaaatgtgatcaaaatttaac |
34207945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University