View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_63 (Length: 227)
Name: NF19917_low_63
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_63 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 4 - 227
Target Start/End: Complemental strand, 43562292 - 43562067
Alignment:
| Q |
4 |
agtcggttagatgattaatttagattacgttgaaatttacatagaattgaatta-ccatatctttaaacatgtgcctttg-gtgtgacaagtgtacgaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||| ||||| ||||||||||||||||||| |
|
|
| T |
43562292 |
agtcggttagatgattaatttagattacgttgaaatttacatagaattgaattaaccataattttaaccatgtgtctttgtgtgtgacaagtgtacgaaa |
43562193 |
T |
|
| Q |
102 |
aagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactatttctcctcaacaccttccatctctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43562192 |
aagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactatttctcctcaacaccttccatctctt |
43562093 |
T |
|
| Q |
202 |
atctctcaatctctttcccattctaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43562092 |
atctctcaatctctttcccattctaa |
43562067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University