View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_65 (Length: 225)
Name: NF19917_low_65
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 13 - 117
Target Start/End: Complemental strand, 43284372 - 43284268
Alignment:
| Q |
13 |
cacagagcttcttgccaccctcccttcaagggttcaaattccttcattggcctgacagggatccctccgagtttgatggatgaaaatgttcaattccaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284372 |
cacagagcttcttgccaccctcccttcaagggttcaaattccttcattggcctgacagggatccctccgagtttgatggatgaaaatgttcaattccaga |
43284273 |
T |
 |
| Q |
113 |
tgaga |
117 |
Q |
| |
|
||||| |
|
|
| T |
43284272 |
tgaga |
43284268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 43284203 - 43284160
Alignment:
| Q |
182 |
cattgcaaagaagtgtgtagtataggtaagtagtggttggagaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284203 |
cattgcaaagaagtgtgtagtataggtaagtagtggttggagaa |
43284160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University