View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19917_low_66 (Length: 224)

Name: NF19917_low_66
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19917_low_66
NF19917_low_66
[»] scaffold0110 (1 HSPs)
scaffold0110 (1-224)||(2837-3062)


Alignment Details
Target: scaffold0110 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3062 - 2837
Alignment:
1 agtcaataggaaatttagttctgaaattgtacccataggaaaatttattcttcaacataactaaataataaacattcataattacttagattcgatcttc 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||    
3062 agtcaatagggaatttagttctgaaattgtacccataggaaaatttattttttaacataactaaataataaacattcataattacttagattccatcttc 2963  T
101 gattaattagac--ttatatatcatcatacttactcaaatctagaataaatttacttgaattcagaacgacgaaaatactttgttggtcacaactatttg 198  Q
    ||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||    
2962 gattaattagacatatatatatcatcatacttactcaaatctagaataaatttacttgaatttagaatgacgaaaatactttattggtcacaactatttg 2863  T
199 aacacataatttcagcacaccaacaa 224  Q
    |||||||||||| |||||||||||||    
2862 aacacataatttgagcacaccaacaa 2837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University