View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_66 (Length: 224)
Name: NF19917_low_66
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_66 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0110 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3062 - 2837
Alignment:
| Q |
1 |
agtcaataggaaatttagttctgaaattgtacccataggaaaatttattcttcaacataactaaataataaacattcataattacttagattcgatcttc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3062 |
agtcaatagggaatttagttctgaaattgtacccataggaaaatttattttttaacataactaaataataaacattcataattacttagattccatcttc |
2963 |
T |
|
| Q |
101 |
gattaattagac--ttatatatcatcatacttactcaaatctagaataaatttacttgaattcagaacgacgaaaatactttgttggtcacaactatttg |
198 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
2962 |
gattaattagacatatatatatcatcatacttactcaaatctagaataaatttacttgaatttagaatgacgaaaatactttattggtcacaactatttg |
2863 |
T |
|
| Q |
199 |
aacacataatttcagcacaccaacaa |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
2862 |
aacacataatttgagcacaccaacaa |
2837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University