View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19917_low_67 (Length: 220)
Name: NF19917_low_67
Description: NF19917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19917_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 36126132 - 36125947
Alignment:
| Q |
20 |
cacctatgcttttatccaacacttctccactccacccttccctcactatagattccacccacattgctaaatcttcatttgctcccttcccatgcctcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126132 |
cacctatgcttttatccaacacttctccactccacccatccctcactatagattccacccacattgctaaatcttcatttgctcccttcccatgcctcaa |
36126033 |
T |
 |
| Q |
120 |
ataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctcttctcgctcggcccttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126032 |
ataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctcttctcgctcggcccttcat |
36125947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University