View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19918_high_16 (Length: 240)

Name: NF19918_high_16
Description: NF19918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19918_high_16
NF19918_high_16
[»] chr7 (1 HSPs)
chr7 (134-226)||(20356353-20356445)
[»] chr2 (1 HSPs)
chr2 (176-225)||(17157095-17157144)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 134 - 226
Target Start/End: Original strand, 20356353 - 20356445
Alignment:
134 tttagtcttgaatggttaaacgttacatgtaatcttttccttgattacaattgactaatctttgcaattatcttcatatttgatgcacttcat 226  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
20356353 tttagtcttgaatggttaaacgttacatgtaatctttttcttgattacaattgactaatctttgcaattaccttcatatttgatgcacttcat 20356445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 17157095 - 17157144
Alignment:
176 gattacaattgactaatctttgcaattatcttcatatttgatgcacttca 225  Q
    ||||||| ||||| |||| ||||| ||| |||||||||||||||||||||    
17157095 gattacagttgacgaatcattgcatttaacttcatatttgatgcacttca 17157144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University