View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19918_low_10 (Length: 296)
Name: NF19918_low_10
Description: NF19918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19918_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 281
Target Start/End: Original strand, 7199785 - 7200055
Alignment:
| Q |
11 |
cataggttctgtcaaatgtctagtttctgagagacaatagtccatgaatacctagtggatccgttattaattgctgtatttttccctaaaaccatgcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7199785 |
cataggttctgtcaaatgtctagtttctgagagacaatagtccatgaatacctagtggatccgttattaattgctgtattttcccctaaaaccatgcttc |
7199884 |
T |
 |
| Q |
111 |
tgcttcggtttctgatctgcaccgacattggcagccatgtttatcttttttcgacctgttagaattcagagaattctcgagaggaactgatattattaaa |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199885 |
tgcttcggtttctgatctgcactgacattggcagccatgtttatcttttttcgacctgttagaattcagagaattctcgagaggaactgatattattaaa |
7199984 |
T |
 |
| Q |
211 |
gttgaaaaatgaactgattcagatgcaagggaggtcgcaactatttatagaagttgacggacgaagataat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199985 |
gttgaaaaatgaactgattcagatgcaagggaggtcgcaactatttatagaagttgacggacgaagataat |
7200055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 11 - 110
Target Start/End: Original strand, 7206553 - 7206655
Alignment:
| Q |
11 |
cataggttctgtcaaatgtctagtttctgagagacaa---tagtccatgaatacctagtggatccgttattaattgctgtatttttccctaaaaccatgc |
107 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| ||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7206553 |
cataggttctgtcaaatgtctcgtttccgagagacaacaatagtccatgaataactagtggatccattattcattgctgtatttttccctaaaaccatgc |
7206652 |
T |
 |
| Q |
108 |
ttc |
110 |
Q |
| |
|
||| |
|
|
| T |
7206653 |
ttc |
7206655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University