View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19918_low_17 (Length: 237)
Name: NF19918_low_17
Description: NF19918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19918_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 1810895 - 1811103
Alignment:
| Q |
16 |
cacattcacgttcggattaatgtcagcggttctcctcttgaatgccctggtatgtttttgctcgccacctgtttgtcacaattccccattgaggaccctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810895 |
cacattcacgttcggattaatgtcagcggttctcctcttgaatgccctggtatgtttttgctcgccacctgtttgtcacaattccccattgaggaccctc |
1810994 |
T |
|
| Q |
116 |
atgtcaagttcttactgataaagcgtgtg-ttttttgcttgatgtgattcaattagagacttttccgagcataggacgtgtaagggtgcagcaccgaggg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810995 |
atgtcaagttcttactgataaagcgtgtgtttttttgcttgatgtgattcaattagaaacttttccgagcataggacgtgtaagggtgcagcaccgaggg |
1811094 |
T |
|
| Q |
215 |
attcttctc |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
1811095 |
attcttctc |
1811103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University