View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19919_low_4 (Length: 244)
Name: NF19919_low_4
Description: NF19919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19919_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 5269757 - 5269533
Alignment:
| Q |
9 |
caagaatatatattgccataaaaagcctttttccctaaagaaaaagaataattcttcaaaaccttcctgtaaactactccccgacgttgtagttcatttc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5269757 |
caagcatatatattgccataaaaagcatttttccctaaagaaaaagaataattcttcaaaaccatcctgtaaactactcccc-acgttgtagttcatttc |
5269659 |
T |
 |
| Q |
109 |
attgatgggaaattcgaatgggattcctccttccacca-------tacctaaatatttaaacttgtca-gccactccacaataattaaggatttccattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
5269658 |
attgatgggaaattcgaatgggattcctccttccaccaaaaatggtacctaaatatttaaacttgtcaggctactccacaaaaattaaggatttccattg |
5269559 |
T |
 |
| Q |
201 |
ggaccttaattgaaattactttgcta |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5269558 |
ggaccttaattgaaattactttgcta |
5269533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University