View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1991_high_3 (Length: 380)
Name: NF1991_high_3
Description: NF1991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1991_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 12 - 363
Target Start/End: Original strand, 11401368 - 11401719
Alignment:
| Q |
12 |
aagaaaccttgatgttctgatggaattttatgaaatacacaattagtcaacaccaacgtgtgcaaaagaaatttcagttaattgcaaaatattatgtcaa |
111 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11401368 |
aagaaaccttgatgctttgatggaattttatgaaatacacaattagtcaacaccaacgtgtgcaaaagaaatttcagttaattttaaaatattatgtcaa |
11401467 |
T |
 |
| Q |
112 |
gacaggtcacacaaacaatatcaacaatgacaaatgacaactgtaagaaaattaaatcaagcataaactagaagattttagaagcattctagaagacaag |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11401468 |
gacaggtcacacaaacaatataaacaatgacaaatgacaaccgtaagaaaattaaatcaagcataaactagaagattttagaagcattccagaagacaag |
11401567 |
T |
 |
| Q |
212 |
tcttcaccattaagaaatgatgatactactggaccacttgaagataaggagcaccgtttgttttatctttacttgtaagaaacttagccatcaagcatgt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401568 |
tcttcaccattaagaaatgatgatactactggaccacttgaagataaggagcaccgtttgttttatctttacttgtaagaaacttagccatcaagcatgt |
11401667 |
T |
 |
| Q |
312 |
atcttgcttacatgcaagactatctttattaaaatatctgaaccgtctcttc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| || |||||| |
|
|
| T |
11401668 |
atcttgcttacatgcaagactatctttattaaattatctgaaacgcctcttc |
11401719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University