View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1991_high_7 (Length: 250)
Name: NF1991_high_7
Description: NF1991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1991_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 4886385 - 4886619
Alignment:
| Q |
19 |
cctcactcaccccctgaccacacatacacaaacaaactctatactttagtgatttcaatagtatttgcgttaggaatggaaggttgggtatactcat--- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4886385 |
cctcactcaccccctgaccacacatacacaaacaaactctatacttaagtgatttcaatagtatttgcgttaggaatggaaggttgggtatactcatcat |
4886484 |
T |
|
| Q |
116 |
aagcgacacatggttatagtaagtgatggggacttgttagcaagcaaaaaactttgaaacttttgatagggttgtcactggggtgtgcgtgtatcaatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4886485 |
aagcgacacatggttatagtaagtgatggggacttgttagcaagcaaaaaactttgaaacttttgatagggttgtcactggggtgtgcgtgtatcaatca |
4886584 |
T |
|
| Q |
216 |
atagttgacacttgtcggccaataataaatatttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4886585 |
atagttgacacttgtcggccaataataaatatttt |
4886619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University