View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_high_21 (Length: 250)
Name: NF19920_high_21
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 13705599 - 13705717
Alignment:
| Q |
15 |
tatgatataaatgagggtggatcaacttgatttatgcaagacttttggaaaattatattgccaatccaacaattgaaattgagtacttgtacatagctat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13705599 |
tatgatataaatgagggtggatcaacttggtttatgcaagactttcagaaaattatattgtcaattcaacaattgaaattgagtacttgtacatagctat |
13705698 |
T |
 |
| Q |
115 |
ataagcatattgctgatgc |
133 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
13705699 |
ataagcatattgttgatgc |
13705717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 124
Target Start/End: Original strand, 13643198 - 13643307
Alignment:
| Q |
15 |
tatgatataaatgagggtggatcaacttgatttatgcaagacttttggaaaattatattgccaatccaacaattgaaattgagtacttgtacatagctat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13643198 |
tatgatataaatgagggtggatcaacttagattatgcaagactttccgaaaattatattgtcaatccaacaattgaaattgagtacttgtacatagctat |
13643297 |
T |
 |
| Q |
115 |
ataagcatat |
124 |
Q |
| |
|
|||||||||| |
|
|
| T |
13643298 |
ataagcatat |
13643307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University