View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_high_29 (Length: 204)
Name: NF19920_high_29
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 37462064 - 37462256
Alignment:
| Q |
1 |
tttacttctctgtaaatcagcaataagaagcactattttagatcaaaatcagttagaagattcttgattgcttggtagtttaattgagaaagttttatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37462064 |
tttacttctctgtaaatcagcaataagaagcactattttagatcaaaatcagttagaagattcttgattgcttggtaatttaattgacaaagttttatag |
37462163 |
T |
|
| Q |
101 |
agtatgtgtttaatttctctgtggaattgttgttattttgttttttcaggctggatattcatctccaactcaagaagctattaggaaggatct |
193 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37462164 |
agtatgtgtttaatttctctttggaattgttgttattttgttttttcaggctggatattcatctccaactcaagaagctattaggaaggatct |
37462256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 136 - 193
Target Start/End: Complemental strand, 37592156 - 37592099
Alignment:
| Q |
136 |
ttttgttttttcaggctggatattcatctccaactcaagaagctattaggaaggatct |
193 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||| ||||||| ||||| |||| |||||| |
|
|
| T |
37592156 |
ttttgtttttccagactgggtattcatctccagctcaagatgctatcaggagggatct |
37592099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University