View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_low_11 (Length: 355)
Name: NF19920_low_11
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 24677665 - 24678018
Alignment:
| Q |
1 |
cggagttgacggatttgatagagaaattgttggagaaggatcctaagaagagattaggttattcacgtggtgctgttgagattaaagagcatgcattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677665 |
cggagttgacggatttgatagagaaattgttggagaaggatcctaagaagagattaggttattcacgtggtgctgttgagattaaagagcatgcattttt |
24677764 |
T |
|
| Q |
101 |
cagaggagtacgttgggaaatattgacggaggtgattcggccaccgtttcttccggcgagatatgacgatgccggggaattttcgtcagagaagttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
24677765 |
cagaggagtacgttgggaaatattgacggaggtgattcggccgccgtttcttccggcgagatatgatgatgccggggaattttcgtcggagaagttatca |
24677864 |
T |
|
| Q |
201 |
aatgggactggtggtgtggatattaaggactatttttagcggatgaactcgccgtcattgccgccgtcgccgtcttgtaagttgagaaaaaatgtttcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677865 |
aatgggactggtggtgtggatattaaggactattttcagcggatgaattcgccgtcattgccgccgtcgccgtcttgtaagttgagaaaaaatgtttcct |
24677964 |
T |
|
| Q |
301 |
taaaggaattctaatgcccgtgctggtcgttgattgcacgtgcaagagttagtt |
354 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24677965 |
taaaggaattctaatgcacgtgctggtcgttgattgcacgtgcacgagttagtt |
24678018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University