View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_low_16 (Length: 306)
Name: NF19920_low_16
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 19451989 - 19451702
Alignment:
| Q |
1 |
cgaattctatcacctttgttggtgtgttgagtgcatgtaatcatagtggaatggttgatgaagggttgatgtattttgaaatgatgactaaggaatacaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
19451989 |
cgaattctatcacttttgttggtgtgttgagtgcatgtaatcatagtggaatggttgatgaagggttaatgtattttgaaatgatgactaaagagtacaa |
19451890 |
T |
 |
| Q |
101 |
tgttgaaccaagtttggtgcattttgggtgtcttgttgatctttacgctagagctggacatattcaagccgctctgaatgtcatttcagaaatgccgatt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||| |||| ||||| ||||| |||| |||||||||||| |
|
|
| T |
19451889 |
tgttgaaccaagtttggtgcattatggatgtcttgttgatctttatgctagagctggacatatccaagaggctctcaatgtggtttcggaaatgccgatt |
19451790 |
T |
 |
| Q |
201 |
aaaccagatgctgtaatttggaggagtcttttagatgcttgttataagcaacatgcaagtattgagctaagtgaagaaatggcaaagc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19451789 |
aaaccagatgctgtaatttggaggagtcttttagatgcttgttataagcaacatgcaagtgttgagctaagtgaagaaatggcaaagc |
19451702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University