View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_low_23 (Length: 250)
Name: NF19920_low_23
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 28966349 - 28966110
Alignment:
| Q |
1 |
aaatccttaagtagtttaataaaaaacatcatggcccggtttgatcactcagagttttgcacttgctaatagtatgagacaattggagcttgaaaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
28966349 |
aaatccttaagtagtttaataaaaaacatcatggcccggtttgatcactcagagttttgcacttgctaatagtatgtgacaattggagcttgaaaaattg |
28966250 |
T |
 |
| Q |
101 |
tactaaaaattaaaataaaggatagttacttggttgtagaaaactggtacgaagtttcgttcaaaagtccattctggttaggagagctgtattattatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966249 |
tactaaaaattaaaataaaggatagttacttggttatagaaaactggtacgaagtttcgttcaaaagtccattctggttaggagagctgtattattatac |
28966150 |
T |
 |
| Q |
201 |
cccttttttggctttagctagctttacattgaaacctatg |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28966149 |
ccctttttaggctttagctagctttacattgaaacctatg |
28966110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University