View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19920_low_24 (Length: 238)
Name: NF19920_low_24
Description: NF19920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19920_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 37545188 - 37545106
Alignment:
| Q |
139 |
ttaagataaataagattgttacagtgttatgccagtttcggaaatacttggcatacacatttgattatcatattatcaaattc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37545188 |
ttaagataaataagattgttacagtgttatgccagtttcgaaaatacttggcatacacatttgattatcatattatcaaattc |
37545106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 39 - 140
Target Start/End: Original strand, 4433880 - 4433985
Alignment:
| Q |
39 |
taaaatattataagctagcaccgttaaaagagaa-at---cacatgaatttatcttgtcgtgcaaattcgtgtgctaataatgtcgtgcggtatagcaat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
4433880 |
taaaatattataagctagcaccgttaaaagagaagatagccacatgaatttgtcttgtcgtgcaaattcgtgtgctaacacagtcgtgcggtatagcaat |
4433979 |
T |
|
| Q |
135 |
cctctt |
140 |
Q |
| |
|
|||||| |
|
|
| T |
4433980 |
cctctt |
4433985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 4433813 - 4433852
Alignment:
| Q |
1 |
cacaaggctaaataccacatcttgtcttctctgatgttta |
40 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4433813 |
cacaaggctaaataccatatcttgtcttctctgatgttta |
4433852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 11829242 - 11829281
Alignment:
| Q |
1 |
cacaaggctaaataccacatcttgtcttctctgatgttta |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11829242 |
cacaaggctaaataccacatcttgtcttctctgacgttta |
11829281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 37 - 72
Target Start/End: Original strand, 11829307 - 11829342
Alignment:
| Q |
37 |
tttaaaatattataagctagcaccgttaaaagagaa |
72 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11829307 |
tttaaaatattataaactagcaccgttaaaagagaa |
11829342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University