View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_high_22 (Length: 283)
Name: NF19921_high_22
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_high_22 |
 |  |
|
| [»] scaffold0043 (5 HSPs) |
 |  |  |
|
| [»] scaffold1163 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0043 (Bit Score: 249; Significance: 1e-138; HSPs: 5)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 29009 - 28737
Alignment:
| Q |
1 |
atgcaaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaatgtaaaggaaatttacaatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29009 |
atgcaaaagagaaatcaatttcaatttggactctttgttagatacaagatggtcaagatctgatgatgagtccaacaaagtaaaggaaatttacaatcca |
28910 |
T |
 |
| Q |
101 |
tgcaaaagagaaatcaatttcagcgtatgcaactcaagtgcaatgacatgattcttaactggattattgccaagatcattttacgcaagcaagaaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
28909 |
tgcaaaagagaaatcaatttcagcgtatgcaactcaagtgcaatgacatgattcttcacttgattattgccaagatcattctacgcatgcaagaaaattt |
28810 |
T |
 |
| Q |
201 |
tggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28809 |
tggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
28737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #2
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 43867 - 43595
Alignment:
| Q |
1 |
atgcaaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaatgtaaaggaaatttacaatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43867 |
atgcaaaagagaaatcaatttcaatttggactctttgttagatacaagatggtcaagatctgatgatgagtccaacaaagtaaaggaaatttacaatcca |
43768 |
T |
 |
| Q |
101 |
tgcaaaagagaaatcaatttcagcgtatgcaactcaagtgcaatgacatgattcttaactggattattgccaagatcattttacgcaagcaagaaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
43767 |
tgcaaaagagaaatcaatttcagcgtatgcaactcaagtgcaatgacatgattcttcacttgattattgccaagatcattctacgcatgcaagaaaattt |
43668 |
T |
 |
| Q |
201 |
tggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43667 |
tggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
43595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 51192 - 51261
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
|||||||||| ||| |||||| |||| |||| | |||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
51192 |
aaaagagaaaacaaattcaatatggaatcttggttagatagaagatggtcaaggtctgatgaagagtcca |
51261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 122
Target Start/End: Complemental strand, 29015 - 28987
Alignment:
| Q |
94 |
caatccatgcaaaagagaaatcaatttca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29015 |
caatccatgcaaaagagaaatcaatttca |
28987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 122
Target Start/End: Complemental strand, 43873 - 43845
Alignment:
| Q |
94 |
caatccatgcaaaagagaaatcaatttca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43873 |
caatccatgcaaaagagaaatcaatttca |
43845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 165 - 270
Target Start/End: Original strand, 22668379 - 22668484
Alignment:
| Q |
165 |
tattgccaagatcattttacgcaagcaagaaaattttggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaat |
264 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
22668379 |
tattgccaggatcattttatgcaagcaagaaaattttggtaggattgatgatcttgacttaaggttaatgtggttgatcaagaatagaactttagtcaat |
22668478 |
T |
 |
| Q |
265 |
tggcct |
270 |
Q |
| |
|
|||||| |
|
|
| T |
22668479 |
tggcct |
22668484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 22395317 - 22395240
Alignment:
| Q |
1 |
atgcaaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22395317 |
atgcaaaagagaaatcaatttcgatttggactcttggtcagatacaagatggtcaaggtctgatgatgagtccaacaa |
22395240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1163 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold1163
Description:
Target: scaffold1163; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 721 - 644
Alignment:
| Q |
1 |
atgcaaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
721 |
atgcaaaagagaaatcaatttcgatttggactctttgttagatacaagatggtcaaggtctgatgatgagtccaacaa |
644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 27388318 - 27388395
Alignment:
| Q |
1 |
atgcaaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27388318 |
atgcaaaagagaaatcaatttcgatttggactctttgttagatacaagatggtcaaggtctgatgatgagtccaacaa |
27388395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 28085403 - 28085334
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28085403 |
aaaagagaaatcaatttcaatttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
28085334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 27980775 - 27980706
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27980775 |
aaaagaaaaatcaattttaatttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
27980706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 28006281 - 28006212
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
||||||||||||| ||| |||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28006281 |
aaaagagaaatcatttttgatttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
28006212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 26631086 - 26631022
Alignment:
| Q |
11 |
gaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtccaa |
75 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
26631086 |
gaaatcaattttgatttggactcttggttagatacaagatcgtcaaggtctgacgatgagtccaa |
26631022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 19482752 - 19482821
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
||||| |||||||||||| ||| ||||||| | ||||||||||||||||||| |||||| |||| |||| |
|
|
| T |
19482752 |
aaaagcgaaatcaatttctttttagactcttggttagatacaagatggtcaaggtctgataatgattcca |
19482821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 27350496 - 27350427
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
|||||||||| ||| |||||| |||| |||| | |||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
27350496 |
aaaagagaaaacaaattcaatatggaatcttggttagatagaagatggtcaaggtctgatgaagagtcca |
27350427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 74
Target Start/End: Complemental strand, 6164127 - 6164058
Alignment:
| Q |
5 |
aaaagagaaatcaatttcaatttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
|||||||||||| | |||||||||||||| | | |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
6164127 |
aaaagagaaatcgacttcaatttggactcgtggttagatataagatggtcaaggtctgatgatgagtcca |
6164058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 74
Target Start/End: Original strand, 6164667 - 6164702
Alignment:
| Q |
39 |
tagatacaagatggtcaagatctgatgatgagtcca |
74 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6164667 |
tagatacaagatggtcaaggtctgatgatgagtcca |
6164702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University