View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_high_24 (Length: 274)
Name: NF19921_high_24
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 13774880 - 13774635
Alignment:
| Q |
18 |
gaattactatgggctgcagcatggctttatcgcgcttctaacttgaaaaaatacctcgattaccttggaggagcaggcgacaatggaggtgctagaacaa |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13774880 |
gaattactatgggcagcagcatggctttaccacgctacaaacttgaaaaaatacctcgattaccttggaggagcaggcgacaatggaggtgctagaacaa |
13774781 |
T |
 |
| Q |
118 |
tgtttagttgggatgacaagtatcttggtgcacagattcttgctgcaaaggtatatataactcaatagcattcatcttcctaaagctaattagaaaattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13774780 |
tgtttagttgggatgacaagtatcttggtgcacagattcttgctgcaaaggtatatataactcaatagcattcatcttcctaaagctaattagaaaattt |
13774681 |
T |
 |
| Q |
218 |
tgatatttttaatgtttttattactacttaattattctgttatatt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13774680 |
tgatatttttaatgtttttattactacttaattattctgttatatt |
13774635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 84 - 193
Target Start/End: Original strand, 16854161 - 16854270
Alignment:
| Q |
84 |
ggaggagcaggcgacaatggaggtgctagaacaatgtttagttgggatgacaagtatcttggtgcacagattcttgctgcaaaggtatatataactcaat |
183 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
16854161 |
ggaggagcaggcgacaatgggggtgcaagaacgatgtttagctgggatgacaagtatgttggtgcacaaattcttgctgcaaaggtatatataattcaat |
16854260 |
T |
 |
| Q |
184 |
agcattcatc |
193 |
Q |
| |
|
|||||||||| |
|
|
| T |
16854261 |
agcattcatc |
16854270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University