View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_high_28 (Length: 255)
Name: NF19921_high_28
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 10316454 - 10316676
Alignment:
| Q |
15 |
cacagatgatgtttcattgtttatgtcattgctcaaacatgtgtcttgtgaaatgctcaccatagaattgttggtggagaattgctccatcttgcactct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10316454 |
cacagatgatgtttcattgtttatgtcattgctcaaacatgtgtcttgtgaaatgctcaccatagaattgttggtagagaattgctccatcttgcactct |
10316553 |
T |
 |
| Q |
115 |
ttattttccaatccataaatgtaaccattgttattattcccttgattcatgtaagaataatttgataacatgttctcattcaagggtgtgtttggaattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10316554 |
ttattttccaatccataaatgtaaccattgttattattcccttgattcatgtaagaataatttgataacatgttctcattcaagggtgtgtttggaattt |
10316653 |
T |
 |
| Q |
215 |
ggatttgaggttgaagttgatgt |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10316654 |
ggatttgaggttgaagttgatgt |
10316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University