View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19921_high_35 (Length: 234)

Name: NF19921_high_35
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19921_high_35
NF19921_high_35
[»] chr2 (1 HSPs)
chr2 (48-175)||(16406750-16406877)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 48 - 175
Target Start/End: Complemental strand, 16406877 - 16406750
Alignment:
48 gattgtcagaacacgcaaaaaatttaaagtgttgatgatgcatggtcttctttatgttgaatacactgatttttggaggctccatttgaggtgagcaact 147  Q
    |||| ||| ||||||| |||| ||| ||||||||||| |||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
16406877 gattatcataacacgctaaaattttgaagtgttgatggtgcatggttttctttatgttgaatacattgatttttgtaggctccatttgaggtgagcaact 16406778  T
148 tactcaaacttgtcgttaggagaaaaca 175  Q
    ||||||||||||||||||||||||||||    
16406777 tactcaaacttgtcgttaggagaaaaca 16406750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University