View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_high_38 (Length: 224)
Name: NF19921_high_38
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 48 - 212
Target Start/End: Complemental strand, 22868549 - 22868385
Alignment:
| Q |
48 |
ctgtaggttgcaatacccatgcatatggctcgcattttgacttatcctgagcgtgttacacatcacaacatagaaaagttgagacaatgtgtgagaaatg |
147 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22868549 |
ctgtaggttgcaatacccatccatatggctcgcattttgacttatcctgagcgtgttacacatcacaacatagaaaagttgagacaatgtgtgagaaatg |
22868450 |
T |
|
| Q |
148 |
gtcctgataagtatcctggtgcaaggatggttaaagcggctgggggtaactcatggtctgtgctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
22868449 |
gtcctgataagtatcctggtgcaaggatggttaaagaggctgggggtaactcatggtttgtgctg |
22868385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 51 - 204
Target Start/End: Complemental strand, 22837183 - 22837030
Alignment:
| Q |
51 |
taggttgcaatacccatgcatatggctcgcattttgacttatcctgagcgtgttacacatcacaacatagaaaagttgagacaatgtgtgagaaatggtc |
150 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837183 |
taggttgcaatacccatccatatggctcgcattttgacttatcctgagcgtgttacacatcacaacatagaaaagttgagacaatgtgtgagaaatggtc |
22837084 |
T |
|
| Q |
151 |
ctgataagtatcctggtgcaaggatggttaaagcggctgggggtaactcatggt |
204 |
Q |
| |
|
| |||||||||||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
22837083 |
ccgataagtatcctggtgcaaggatgcttaaagaggctggaggtaactcatggt |
22837030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University