View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_high_39 (Length: 221)
Name: NF19921_high_39
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 10902172 - 10902002
Alignment:
| Q |
20 |
gtgtattgaaaatactcagccaaatattttctcaaaataaatgacttatagatttgatagttgggtgtaatagaaattttgtgacctatttgacacattt |
119 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10902172 |
gtgttttggaaatactcagccaaatatcttctcaaaataaattacttatagatttgatagt-gggtgtaatagaaattttgtgacctatttgacacattt |
10902074 |
T |
 |
| Q |
120 |
gtcttgtaggtggaatacctaaagtcaagcccataaaacacgtcccagcattattgatgagcattacttttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10902073 |
gtcttgtaggtggaatacctaaagtcaagcccataaaacacgtcccaacattattgatcagcattacttttt |
10902002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University