View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_low_12 (Length: 417)
Name: NF19921_low_12
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 41 - 270
Target Start/End: Original strand, 47577010 - 47577241
Alignment:
| Q |
41 |
cataatctttccaccatcattattatccaaaattgaaacttggctgcaacaacag--cagactcattcacacacacaacctcatggtaattaaaaacata |
138 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577010 |
cataatttttccaccttcattattatccaaaattgaaacttggctgcaacaacagaacagactcattcacacacacaacctcatggtaattaaaaacata |
47577109 |
T |
|
| Q |
139 |
cattttccatgcgaaccgaaacaaaccaatcaacttgctccgtacgctacaaaagaaaacaaactgaatctcaaactgatataaccggtgtctgctgctc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577110 |
cattttccatgcgtaccgaaacaaaccaatcaacttgctccgtacgctacaaaagaaaacaaactgaatctcaaactgatataaccggtgtctgctgctc |
47577209 |
T |
|
| Q |
239 |
atgaggtggacctttacacctctcatttcatg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47577210 |
atgaggtggacctttacacctctcatttcatg |
47577241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 342 - 404
Target Start/End: Original strand, 47577311 - 47577373
Alignment:
| Q |
342 |
aaccataattatatgatcatagaatggaataaaaacatgtgtatacgtggggttggtgaagaa |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577311 |
aaccataattatatgatcatagaatggaataaaaacatgtgtatacgtggggttggtgaagaa |
47577373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University