View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_low_19 (Length: 340)
Name: NF19921_low_19
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_low_19 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 322
Target Start/End: Original strand, 137335 - 137644
Alignment:
| Q |
13 |
aatattcaggagacttttgaaaaaatatattatgctttcttctagnnnnnnn-ataagcaaaaatttattaaatatatttgcaaacttgcaccagacatg |
111 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| ||||||||||| ||||||||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
137335 |
aatattcaggagacttttgataaaatacattattctttcttctagttttttttataagcaaaaatttattaa-tatatttgcaaagtagcaccagacatg |
137433 |
T |
 |
| Q |
112 |
caaaaccaatttagcacaaaataaataggaaagtaagaatgatggggatttttaatactcatgcacaaggtcaatgaatcaatattatgagttatgacac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137434 |
caaaaccaatttagcacaaaataaataggaaagtaagaatgatggggatttttaatactcatgcacaaggtcaatgaatcaatattatgagttatgacac |
137533 |
T |
 |
| Q |
212 |
tatctttgttgcaaaacatttctggaatgggaaggaaatcttcatcacaactcatcaatattctgtgcttcaatattatcttgcaattgttagcatgttc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137534 |
tatctttgttgcaaaacatttctggaatgggaaggaaatcttcatcacaactcatcaatattctgtgcttcaatattatcttgcaattgttagcatgttc |
137633 |
T |
 |
| Q |
312 |
aagggtgcaaa |
322 |
Q |
| |
|
||||||||||| |
|
|
| T |
137634 |
aagggtgcaaa |
137644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 208 - 265
Target Start/End: Original strand, 6444049 - 6444106
Alignment:
| Q |
208 |
acactatctttgttgcaaaacatttctggaatgggaaggaaatcttcatcacaactca |
265 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6444049 |
acactatcttggttgcaaaacattgctggaatgggaaggaaatcttcattacaactca |
6444106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University