View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_low_20 (Length: 318)
Name: NF19921_low_20
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 34865110 - 34864819
Alignment:
| Q |
17 |
agtttcgaatggttagaccctccctaattaattgtagtctgccgcttcacctattgggaaaactgacaataagattagtaaagagaaatatgggagtggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34865110 |
agtttcgaatggttagaccctccctaattaattgtagtctgccgcttcacctattgggaaaactgacaataagattagtaaagagaaatatgggagtggt |
34865011 |
T |
 |
| Q |
117 |
ggatct-----ccctcaaaatgcaaacataatgagatttgagactagagattcatccatatattgctccttgatgtttcattcagattttcaatctatta |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34865010 |
ggatcggatccccctcaaaatgcaaacataatgagatttgagactagagattcatccatatattgctccttgatgtttcattcagattttcaatctatta |
34864911 |
T |
 |
| Q |
212 |
aaacctttgaattcttaatcaaagccaaatttggatccaccttgaatattctcatcatctcatgtgtataaaatttcatttattcacatcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34864910 |
aaacctttgaattcttaatcaaagccaaatttggatccaccttgaatattctcatcatctcatgtgtataaaatttcatttattcacatcat |
34864819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University