View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19921_low_36 (Length: 234)
Name: NF19921_low_36
Description: NF19921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19921_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 48 - 175
Target Start/End: Complemental strand, 16406877 - 16406750
Alignment:
| Q |
48 |
gattgtcagaacacgcaaaaaatttaaagtgttgatgatgcatggtcttctttatgttgaatacactgatttttggaggctccatttgaggtgagcaact |
147 |
Q |
| |
|
|||| ||| ||||||| |||| ||| ||||||||||| |||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
16406877 |
gattatcataacacgctaaaattttgaagtgttgatggtgcatggttttctttatgttgaatacattgatttttgtaggctccatttgaggtgagcaact |
16406778 |
T |
|
| Q |
148 |
tactcaaacttgtcgttaggagaaaaca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16406777 |
tactcaaacttgtcgttaggagaaaaca |
16406750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University