View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_10 (Length: 401)
Name: NF19922_high_10
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 22 - 398
Target Start/End: Complemental strand, 30581274 - 30580893
Alignment:
| Q |
22 |
gggccgatttgctggaatcctttgtaggatttgaagttggagagttccaggcggaggattttgcctggcgagtgcagcgatggcatggttgcggtggtgg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30581274 |
gggccgatttgctggaatcctttgtaggatttgaagttggagagttccaggcggaggattttgcctggcgagtgcagagatggcatggttgcggtggtgg |
30581175 |
T |
|
| Q |
122 |
aagagatcc-ctagcggagaggaaatttggggggagaaagaggggttagggtttggaagtgaaaatgaattggcgggattgtgaatttcagtgattgtgg |
220 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30581174 |
aagagaaacactagcggagagggaatttggggggagaaagaggggttagggtttggaagtgaaaatgaattggcgggattgtgaatttcagtgattgtgg |
30581075 |
T |
|
| Q |
221 |
aattttgatttggtacggttattattatcggcttttctgtagcatgacgatgcgttactaaatttagtgacgagtgtacttaggaagtattaa------c |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
30581074 |
aattttgatttggtacggttattattatcggcttttttgtagcatgacgatgcgttactaaatttagtgacgagtgtgcttaggaagtattaacattaac |
30580975 |
T |
|
| Q |
315 |
atttaacatcacttgcttagtggaagttactggattaacatcacttgaagtgattctaggacacaacatattgatgatgtccat |
398 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
30580974 |
atttaacatcacttgctta--ggaagttactggattaacatcacttgaagtgattctaggacacaacaaattgattatgtccat |
30580893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University