View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_15 (Length: 369)
Name: NF19922_high_15
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 165 - 277
Target Start/End: Original strand, 33636008 - 33636120
Alignment:
| Q |
165 |
cagcaaaaatgtgtaatgtttaaagtttgatatttataaaatactagatacatgagaaagcgcaaggagctttattgtaactaattatttgtcaaaaata |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636008 |
cagcaaaaatgtgtaatgtttaaagtttgatatttataaaatactagatacatgagaaagcgcaaggagctttattgtaactaattatttgtcaaaaata |
33636107 |
T |
 |
| Q |
265 |
agtagttttatag |
277 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33636108 |
agtagttttatag |
33636120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 244 - 359
Target Start/End: Original strand, 33636121 - 33636234
Alignment:
| Q |
244 |
actaattatttgtcaaaaataagtagttttatagtgttccctatatagtggcaaacattagtcacatgtgtactcactgttctaagtcacccacaaacat |
343 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33636121 |
actaattatttgtccaaa-taagtagtttt-tagtgttccctatatagtggcaaacattagtcacatgtgtactcattgttctaagtcacccacaaacat |
33636218 |
T |
 |
| Q |
344 |
tatatatcttcttctt |
359 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33636219 |
tatatatcttcttctt |
33636234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 148
Target Start/End: Original strand, 33635961 - 33635990
Alignment:
| Q |
119 |
tcattcctcctacttttaattgtgtaatga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33635961 |
tcattcctcctacttttaattgtgtaatga |
33635990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University