View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_20 (Length: 340)
Name: NF19922_high_20
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 45 - 326
Target Start/End: Original strand, 43068719 - 43069000
Alignment:
| Q |
45 |
caaatattgttttaagaagtagactatgtcttaatgtcttataaaaatagtcgataagttggatgatagcaaattaattgctcaagctctatgtagtcaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43068719 |
caaatattgttttaagaagtagactatgtcttaatatcttataaaaatagtcgataagttggatgatagcaaattaattgctcaagctccatgtagtcaa |
43068818 |
T |
|
| Q |
145 |
atcatggaaggttttgatttaatctcaatattttatatcataaaattaaaatattttattaaccgtctaatcttgattgaacgatcaccaatgtttccaa |
244 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| || |
|
|
| T |
43068819 |
atcatggaagattttgatttaatctcaatattttatattataaaattaaaatattttattaaccgtctaatcttgatcgaacgatcatcaatatttcgaa |
43068918 |
T |
|
| Q |
245 |
tgcatggatgtgtgattttgttgaccgtggtgaaaacatttttcaaattaattgataataattgaagattggaagtatgaat |
326 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43068919 |
tgcatgaatgtgtgattttgttgacggtggtgaaaacatttttcaaattaattgataatacttgaagattggaagtatgaat |
43069000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 43068662 - 43068698
Alignment:
| Q |
12 |
agagagggggagagagattgtcattttcccacacaaa |
48 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43068662 |
agagggggggagagagattgtcattttcccacacaaa |
43068698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University