View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_26 (Length: 313)
Name: NF19922_high_26
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 4 - 265
Target Start/End: Original strand, 34264120 - 34264381
Alignment:
| Q |
4 |
tagtactagtagaacagttatttgatactaccaaccaactactatcattatttatcagtactaactttgctttggactatggtattgtaagagaattaaa |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34264120 |
tagtactagtagaacagttatatgatactaccaaccaactactatcattatttatcagtactaactttgctttggactatggtattgtaagagaattaaa |
34264219 |
T |
 |
| Q |
104 |
tatttaatgggattattaggaaggatagattaagccacggtcctactttggatatgcagtggttgtaccattaatgaatgttaccttttgcataatccac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34264220 |
tatttaatgggattattaggaaggatagattaagccacggtcctactttggatatgcagtggttgtaccattaatgaatgttaccttttgcataatccac |
34264319 |
T |
 |
| Q |
204 |
tctactttcttcttctaatctttttcatgctaacttcgtgtacttcatcatacctcagcaag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34264320 |
tctactttcttcttctaatctttttcatgctaacttcgtgtccttcatcatacctcagcaag |
34264381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University