View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_27 (Length: 306)
Name: NF19922_high_27
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 12 - 306
Target Start/End: Complemental strand, 44307946 - 44307658
Alignment:
| Q |
12 |
agagaaatcaaaagaggaaagaggtgtggataagatgaatgggtgtaaattaatcgtttatcatattgtaaggttaaaatataaagatacatagctcaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44307946 |
agagaaatcaaaagaggaaagaggtgtggataagatgaatgggtgtaaattaatcgtttatcatattgtaaggttaaaatataaagatacatagctcagg |
44307847 |
T |
 |
| Q |
112 |
taataagggccgacaattttcgtcacataacctttatttgtgtcaattgttgggatgaacaaaacaacattatcaatttatattctctcaattatttggt |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44307846 |
taataagggccgacaattttcgtcccataacctttatttgtgtcaattgttgggatgaacaaaacaacattatcaatttatattctctcaattatttggt |
44307747 |
T |
 |
| Q |
212 |
tacattttgatgtatgaactgccccatacattatgttggaagaagaaattgtaagaaaccggagccattccatagatggaatcccttcacaactt |
306 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44307746 |
ta------aatgtatgaactgccccatacattatgttggaagaagaaattgtaagaaaccggagccattccatagatggtatcccttcacaactt |
44307658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University