View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19922_high_28 (Length: 300)
Name: NF19922_high_28
Description: NF19922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19922_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 50 - 282
Target Start/End: Complemental strand, 44307551 - 44307321
Alignment:
| Q |
50 |
aaatgagtttaatgtgaatttcacaagtttacatttggtgtcgatctttt---gtcttcttggataatgtaacaaatatcaaatagagatgaatttcatt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44307551 |
aaatgagtttaatgtgaatttcacaagtttacatttggtgtcgatctattattgtcttcttggataatgtaacaaatatcaaatagagatgaatttcatt |
44307452 |
T |
 |
| Q |
147 |
ttattttatttttatgggaaaattatccctcctcctagtaatgtaaatttaacacattttgtttgttatgagacaggaacaatatggacaacaagctctc |
246 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44307451 |
ttttttt-----tatgggaaaattatccctcctcctagtaatgaaaatttaacacattttgtttgttatgagacaggaacaatatggacaacaagctctc |
44307357 |
T |
 |
| Q |
247 |
atataataacagctgtgattgggtctggggtgctat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44307356 |
atataataacagctgtgattgggtctggggtgctat |
44307321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 44307620 - 44307568
Alignment:
| Q |
7 |
gaacaggtacacattaattcatttcattatataattttacattaaatgagttt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44307620 |
gaacaggtacacattaattcatttcattatataattttacattaaatgagttt |
44307568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 280
Target Start/End: Complemental strand, 44325029 - 44324964
Alignment:
| Q |
215 |
tgagacaggaacaatatggacaacaagctctcatataataacagctgtgattgggtctggggtgct |
280 |
Q |
| |
|
|||| ||||||| || ||||| ||| |||| || ||||||||||||||||| || ||||||||||| |
|
|
| T |
44325029 |
tgagtcaggaaccatttggactacatgctcccacataataacagctgtgataggatctggggtgct |
44324964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University